USPTO Patents Application 10551504

(19)

Europaisches Patentamt
European Patent Office
Office europeen des brevets

(11)

EP 1 035 132 A1

(12)

EUROPEAN PATENT APPLICATION

published in accordance with Art. 158(3) EPC

(43) Date of publication:

(51)

int. ci. 7 : C07K 16/18, C07K 16/28,

13.09.2000 Bulletin 2000/37

C1 2N 5/20 A61 K 39/395

(21) Application number: 98941848.8

// (C12P21/08, C12N15:06)

(22) Date of filing: 11.09.1998

(86)

International application number:

PCT/JP98/04118

/Q7\

international publication number.

WO 99/1 2973 (1 8.03. 1 999 Gazette 1 999/1 1 )

(84) Desianated Contractina States"

(72)

Inventors"

AT BE CH CY DE DK ES Fl FR GB GR IE IT LI LU

•

FUKUSHIMA, Naoshi

MC NL PT SE

Chugai Seiyaku Kabushiki Kaisha

Gotemba-shi Shizuoka 412-8513 (JP)

(30) Priority: 1 1.09.1997 J P 26485397

•

UNO, Shinsuke

(71) Applicant:

Chugai Seiyaku Kabushiki Kaisha

Gotemba-shi Shizuoka 412-8513 (JP)

CHUGAI SEIYAKU KABUSHIKI KAISHA

Tokyo, 115-8543 (JP)

(74)

Representative: HOFFMANN - EITLE

Patent- und Rechtsanwalte

Arabellastrasse 4

81925 Miinchen (DE)

<

CM
CO

m

CO

(54)

MONOCLONAL ANTIBODY INDUCING APOPTOSIS

(57) A monoclonal antibody which is an antibody
specifically recognizing human integrin associated pro-
teins and is an antigen inducing the apoptosis of nucle-
ated blood cells having the human integrin associated
proteins. Therefore, it is useful as an antibody, which
specifically recognizes the human integrin associated
proteins, in discriminating and identifying these pro-
teins. Owing to the effect of inducing the apoptosis of
nucleated blood cells, the above antibody is also usable
as remedies, etc. in the fields of, for example, treating
myelocytic leukemia and lymphatic leukemia.

Fig.1

Q_
LU

Printed by Xerox (UK) Business Services
2.16.7 (HRS)/3.6

EP 1 035 132 A1

Description
TECHNICAL FIELD

5 [0001] This invention relates to novel monoclonal antibodies having the property of inducing apoptosis of nucleated
blood cells with Integrin Associated Protein (IAP), as well as to their fragments, peptides and low molecular compounds,
and to hybridomas that produce the monoclonal antibodies. The novel antibodies are useful as therapeutic agents for
myeloid leukemia and lymphoid leukemia.

10 BACKGROUND ART

[0002] Granulocyte colony-stimulating factors, such as recombinant granulocyte colony-stimulating factor (rG-
CSF), have been known in the prior art as humoral factors that stimulate differentiation and proliferation of granulocytes.
Reports based on in vivo experiments with mice have shown that administration of rG-CSF results in not only acceler-
15 ated myelopoiesis in bane marrow but also notable extramedullar hemopoiesis in the spleen, and proliferation of all
hemopoietic precursor cells, including hemopoietic stem cells, in the spleen. The mechanism of such extramedullar
hemopoiesis in the spleen has been believed that stimulation by rG-CSF alters the hemopoietic microenvironment of
the spleen and promotes the hemopoiesis supporting ability thereof, thus inducing hemopoiesis.

[0003] In order to elucidate the hemopoietic function in the spleen, the present inventors have previously focused
20 on stromal cells of the spleen following repeated administration of rG-CSF. The inventors have made efforts to examine

how the hemopoietic function is promoted by rG-CSF via stromal cells, and have established a hemopoietic stromal cell

line (CF-1 cells) from mouse spleen by repeated administration of rG-CSF The inventors have studied the hemopoie-

sis-supporting ability of the hemopoietic stromal cells and confirmed the colony-stimulating activity in vitro and the

hemopoietic stem cell-supporting ability in vivo [Blood, 80, 1914 (1992)].
25 [0004] However, while one cell line of the splenic stromal cells has been established (CF-1 cells) and its cytological

characteristics have been studied, specific antibodies that recognize the surface antigens of these cells have never

been prepared, nor have their characteristics been elucidated yet in any way.

DISCLOSURE OF INVENTION

30

[0005] In light of the aforementioned findings relating to splenic stromal cells and the results of prior research, the
present inventors have earnestly made further research aiming at developing specific antibodies that can recognize the
splenic stromal cells, made efforts to prepare monoclonal antibodies using the aforementioned splenic stromal cell line
as a sensitizing antigen, and finally succeeded in obtaining novel monoclonal antibodies.
35 [0006] The inventors have further studied the properties of the monoclonal antibodies obtained as above and found
that the monoclonal antibodies have the property of inducing myeloid cell apoptosis. These monoclonal antibodies have
been designated "BMAP-1 antibody", which will be hereinafter referred to as such.

[0007] The inventors have also examined the antigen recognized by BMAP-1 antibody and found that it is mouse
Integrin Associated Protein (mouse IAP) (Geneank, Accession Number Z25524) by direct expression cloning.

40 [0008] The action of BMAP-1 antibodies has been studied using recombinant cells into which the gene for mouse
IAP had been introduced. Specifically, the mouse IAP gene was introduced into mouse Jurkat cells, which did not
express mouse IAP, by a conventional method to create a mouse lAP-expressing cell line (recombinant Jurkat cells),
and the action of BMAP-1 antibody on the mouse lAP-expressing cells has been investigated by MTS assay and DNA
fragmentation by using flow cytometry (Japanese Patent Application No. HEI 9-67499).

45 [0009] It has been expected upon these findings that monoclonal antibodies for the antigen of human Integrin Asso-
ciated Protein (hereinafter referred to as human IAP; amino acid sequence and base sequence described in J. Cell
Biol., 123, 485-496, 1993; see also Journal of Cell Science, 108, 3419-3425, 1995) should have an effect of inducing
apoptosis of nucleated blood cells that express this antigen (myeloid cells and lymphocytes), and the present inventors
have made efforts to prepare monoclonal antibodies for the antigen of human Integrin Associated Protein and suc-

50 ceeded in obtaining monoclonal antibodies that induce apoptosis of human nucleated blood cells expressing this anti-
gen.

[0010] In other words, it is an object of this invention to provide novel monoclonal antibodies having the property of
inducing apoptosis of nucleated blood cells (myeloid cells and lymphocytes) with human Integrin Associated Protein
(human IAP), and fragments thereof, as well as hybridomas that produce the monoclonal antibodies.
55 [0011] These novel monoclonal antibodies are useful as therapeutic agents for myeloid leukemia and lymphoid
leukemia.

[0012] The reported functions of Integrin Associated Protein are the action of binding with the p chain of integrin
ocVp3 to support binding between ccVp3 and its ligand vitronectin (J. Cell. Biol., 123, 485-496 (1993)), that of inducing

2

EP 1 035 132 A1

inflow of Ca^ 4 " into the vascular endothelium upon adhesion of neutrophils with the vascular endothelium (J. Biol.
Chem., 268, 19931-19934 (1993)), and that of supporting migration of neutrophils through the vascular endothelium
(Proc. Natl. Acad. Sci. USA, 92, 3978-3982 (1 995)), but no reports have been published on its function relating to apop-
tosis of nucleated blood cells.

5 [0013] The monoclonal antibodies of the invention are antibodies that specifically recognize human Integrin Asso-
ciated Protein. They therefore exhibit a function of distinguishing and identifying human Integrin Associated Protein.
[0014] In addition, the monoclonal antibodies of the invention are antibodies that exhibit the property of inducing
apoptosis of nucleated blood cells (myeloid cells and lymphocytes) with human Integrin Associated Protein. Apoptosis
is a phenomenon in which nuclear chromatin DNA is cleaved into nucleosome units (known as a "ladder formation"),

10 resulting in death of the cell and which is also referred to as cell suicide.

[0015] Monoclonal antibodies hitherto known to have the property of inducing apoptosis of nucleated blood cells
(myeloid cells and lymphocytes) include anti-Fas antibody (Cell, 66; 233-243, 1991), anti-CD43 antibody (Blood, 86,
502-51 1 , 1 995) and anti-HLA Class led Domain antibody (Blood, 90, 726-735, 1 997), but the property of inducing apop-
tosis of nucleated blood cells by the Integrin Associated Protein-recognizing antibodies of this invention has never been

15 known. The monoclonal antibodies of the invention are therefore defined as encompassing any monoclonal antibody
capable of specifically recognizing Integrin Associated Protein and having the property of inducing apoptosis of nucle-
ated blood cells (myeloid cells and lymphocytes) with Integrin Associated Protein.

[0016] The antibodies of the invention are not limited only to those that induce apoptosis of all nucleated blood cells.
They also include those that induce apoptosis of at least one type of nucleated blood cells. Specifically, it is sufficient in
20 the case of myeloid leukemia to induce apoptosis of at least myeloid cells.

[0017] More specifically, this invention provides monoclonal antibodies that induce apoptosis of nucleated blood
cells having Integrin Associated Protein (IAP).

[0018] The invention further provides fragments, peptides and low molecular compounds of monoclonal antibodies
that induce apoptosis of nucleated blood cells having Integrin Associated Protein (IAP).
25 [0019] The invention still further provides hybridomas that produce the monoclonal antibodies.

[0020] The invention still further provides an antileukemic agent that contains a substance that binds to IAP and
promotes the action of IAP to induce apoptosis of nucleated blood cells.

[0021] The invention still further provides an antileukemic agent characterized in that the substance is a mono-
clonal antibody.

30 [0022] The invention still further provides an antileukemic agent characterized in that the substance is a fragment,
a peptide or a low molecular compound of the monoclonal antibodies.

BRIEF DESCRIPTION OF DRAWINGS

35 [0023]

Fig. 1 is an electrophoresis pattern showing a band for human IAP amplified by PCR using cDNA prepared from
mRNA of HL-60 cell line. From left are shown a molecular weight marker (M), human IAP (1 ) and (3-actin (2).
Fig. 2 is a graph showing the level of expression of human IAP by L1210 cells that have expressed human IAP,
40 using anti-CD47 antibody. The peak represents L1210 cells transfected with only pCOS1 gene as a control.

Fig. 3 is another graph showing the level of expression of human IAP by L1210 cells that have expressed human
IAP, using anti-CD47 antibody. The peak shows that human IAP expression has definitely increased in L1210 cells
transfected with the human IAP gene.

Fig. 4 is a graph showing antibody titers in immunized mice. The left peak represents intact L1210 cells. The right
45 peak represents L1210 cells transfected with human IAP, showing that the serum of the mouse subjected to cell

fusion clearly recognizes human IAP.

Fig. 5 is a bar graph showing the results of a growth inhibition experiment (Jurkat cells) using a hybridoma culture
supernatant.

Fig. 6 is a bar graph showing the results of a growth inhibition experiment (ARH77 cells) using a hybridoma culture
50 supernatant.

Fig. 7 is a graph showing the apoptosis-inducing effect on Jurkat cells by a culture supernatant (as analyzed by PI
staining), which is the result for an 8G2 culture supernatant used as a control. R1 indicates the percentage (%) of
apoptosis, which is 7.43%.

Fig. 8 is a graph showing the apoptosis-inducing effect on Jurkat cells by a culture supernatant (as analyzed by PI
55 staining), which is the result for 7D2-E3. R1 indicates the percentage (%) of apoptosis, which is 9.84%.

Fig. 9 is a graph showing the apoptosis-inducing effect on Jurkat cells by a culture supernatant (as analyzed by PI

staining), which is the result for 1 1C8. R1 indicates the percentage (%) of apoptosis, which is 15.32%.

Fig. 10 is a graph showing the apoptosis-inducing effect on HL-60 cells by a culture supernatant (as analyzed by

3

EP 1 035 132 A1

PI staining), which is the result for an 8G2 culture supernatant used as a control. M1 indicates the percentage (%)
of apoptosis, which is 6.94%.

Fig. 11 is a graph showing the apoptosis-inducing effect on HL-60 cells by a culture supernatant (as analyzed by
PI staining), which is the result for 1 1C8. M1 indicates the percentage (%) of apoptosis, which is 12.16%.

5 Fig. 12A is a monochrome photomicrograph showing the result of apoptosis analysis (TUNEL method) in a cocul-

turing system with KM-102 and HL-60 cells, using 9C5 culture supernatant as a control. The apoptotic cells are
stained black or brown. The nuclear staining was accomplished with Methyl Green, and the magnification is 100x.
Fig. 1 2B is a color photomicrograph showing the result of apoptosis analysis (TUNEL method) in a coculturing sys-
tem with KM-1 02 and HL-60 cells, using 9C5 culture supernatant as a control. The apoptotic cells are stained black

10 or brown. The nuclear staining was accomplished with Methyl Green, and the magnification is 100x.

Fig. 13A is a monochrome photomicrograph showing the result of apoptosis analysis (TUNEL method) in a cocul-
turing system with KM-102 and HL-60 cells, using 1 1C8 culture supernatant. More TUNEL-positive cells are seen
than in Fig. 12. The apoptotic cells are stained black or brown. The nuclear staining was accomplished with Methyl
Green, and the magnification is 100x.

is Fig. 1 3B is a color photomicrograph showing the result of apoptosis analysis (TUNEL method) in a coculturing sys-

tem with KM-1 02 and HL-60 cells, using 1 1 C8 culture supernatant. More TUNEL-positive cells are seen than in Fig.
1 2. The apoptotic cells are stained black or brown. The nuclear staining was accomplished with Methyl Green, and
the magnification is 100x.

Fig. 14 is an electrophoresis pattern showing the results of SDS-PAGE analysis of IgG purified from hybridoma
20 lines 7D2-E3 and 1 1C8. Shown are molecular weight markers (M, M'), mouse IgG (authentic sample) under non-

reducing conditions (1), 7D2-E3 (2), 11C8 (3), mouse IgG (authentic sample) under reducing conditions (4), 7D2-
E3 (5) and 11C8 (6).

Fig. 15 shows the results of analysis of CD47 expression by flow cytometry, using HL-60 cells.
Fig. 1 6 shows the results of analysis of CD47 expression by flow cytometry, using Jurkat cells.
25 Fig. 17 shows results for mlgG (10 |ug/ml) as a control to demonstrate its apoptosis-inducing effect on L1210 cells

transfected with the human IAP gene (L1210-hlAP) (incubation for 72 hours).

Fig. 18 shows the apoptosis-inducing effect of MABL-1 (10 |ng/ml) on L4210 cells transfected with the human IAP
gene (incubation for 72 hours).

Fig. 19 shows the apoptosis-inducing effect of MABL-2 (10 jug/ml) on L1210 cells transfected with the human IAP
30 gene (incubation for 72 hours).

Fig. 20 shows results for mlgG (10 |ug/ml) as a control to demonstrate its apoptosis-inducing effect on Jurkat cells
(incubation for 48 hours).

Fig. 21 shows the apoptosis-inducing effect of MABL-1 (10 |ng/ml) on Jurkat cells (incubation for 48 hours).
Fig. 22 shows the apoptosis-inducing effect of MABL-2 (10 |ng/ml) on Jurkat cells (incubation for 48 hours).
35 Fig. 23 shows results for mlgG (10 |ug/ml) as a control to demonstrate its apoptosis-inducing effect on L1210 cells

transfected with the human IAP gene introduced therein (L1210-hlAP) (incubation for 72 hours).
Fig. 24 shows the apoptosis-inducing effect of MABL-2 Fab fragments (10 |ug/ml) on L1210 cells transfected with
the human IAP gene.

Fig. 25 is an SDS electrophoresis pattern for MABL-2 antibody Fab fragments.
40 Fig. 26 shows a notably extended survival period upon treatment with MABL-2.

Fig. 27 shows the results of ELISA for Example 5(2).

Fig. 28 shows a notably extended survival period upon treatment with MABL-2 F(ab')2 fragments.
Fig. 29 is an SDS electrophoresis pattern for MABL-1 antibody and MABL-2 antibody F(ab')2 fragments.
Fig. 30 shows that human IgG levels of mouse serum were decreased significantly in the groups treated with
45 MABL-1 and MABL-2, which indicates anti-tumor effects of these antibodies.

BEST MODE FOR CARRYING OUT THE INVENTION

Preparation of Monoclonal Antibody

50

[0024] The monoclonal antibodies of this invention can generally be prepared in the following manner. That is, mon-
oclonal antibodies of the invention may be obtained, for example, by using human Integrin Associated Protein as the
sensitizing antigen, immunizing animals with the antigen by an immunization method known in the art, performing cell
fusion by a cell fusion method known in the art and cloning by a cloning method known in the art.
55 [0025] More specifically, a preferable method of preparing monoclonal antibodies of the invention is, for example, a
method wherein recombinant cells of the mouse leukemia cell line L1 210 that express human Integrin Associated Pro-
tein are used as the sensitizing antigen, plasma cells (immunocytes) of a mammal immunized with the sensitizing anti-
gen are fused with myeloma cells of mammals such as mice, the resulting fused cells (hybridomas) are cloned, the

4

EP 1 035 132 A1

clones producing the antibodies of the invention that recognize the aforementioned cell line are selected from the result-
ing clones and cultured, and the target antibodies are obtained.

[0026] The above method is merely one possible example of the invention and, for example, the sensitizing antigen
is not limited to the aforementioned L1210 recombinant cells but may also be human Integrin Associated Protein (IAP)
5 itself, or human IAP in soluble form; the target monoclonal antibodies that induce apoptosis of nucleated blood cells
(myeloid cells and lymphocytes) can be prepared in the same manner as in the L1210 recombinant cells mentioned
above.

[0027] The phage display method may also be used to prepare a target monoclonal antibody from a cDNA library
for the antibody.

10 [0028] The mammals to be immunized with the sensitizing antigen in the method of preparing the monoclonal anti-
bodies are not particularly limited, but they are preferably selected in consideration of their compatibility with the mye-
loma cells used for cell fusion, and mice, rats, hamsters and the like are general suitable.

[0029] The immunization is preferably accomplished by a standard method. For example, the human Integrin Asso-
ciated Protein-expressing L1210 recombinant cells are administered to the animal by intraperitoneal injection or the
15 like. More specifically, an appropriate dilution or suspension with PBS or physiological saline is preferably administered
to the animal a few times at 10-day intervals. The immunocytes used are preferably spleen cells extracted after the final
administration of the cells.

[0030] The mammalian myeloma cells used as the parent cells for fusion with the immunocytes may be any of var-
ious cell lines known in the art, for example, P3 (P3X63Ag8.653) [J. Immunol., 123, 1548 (1978)], P3-U1 [Current Top-
20 ics in Microbiology and Immunology, 81, 1-7 (1978)], NS-1 [Eur. J. Immunol., 6, 51 1-519 (1976)], MPC-1 1 [Cell, 8, 405-
415 (1976)], Sp2/0-Ag14 (Nature, 276, 269-270 (1978)], FO [J. Immunol. Meth., 35, 1-21 (1980)], S194 [J. Exp. Med.,
148, 313-323 (1978)] and R210 [Nature, 277, 131-133 (1979)].

[0031] The cell fusion between the immunocytes and myeloma cells may be performed basically according to a
conventional method, such as the method of Milstein et al. [Methods Enzymol., 73, 3-46 (1981)].

25 [0032] More specifically, the cell fusion is carried out, for example, in a common nutrient medium in the presence
of a fusion promoter. For example, the fusion promoter used may be polyethylene glycol (PEG), Sendai virus (HVJ) or
the like, and, if desired, an adjuvant such as dimethyl sulfoxide may also be added appropriately in order to increase
fusion efficiency. The immunocytes are used preferably in the amount of 1-10 times as much as myeloma cells. The
medium used for the cell fusion may be, for example, RPMI-1 640 medium, MEM medium and the like, which are suita-

30 ble for growth of myeloma cell lines, or other media commonly used for such cell culturing, and it may also be used in
combination with a serum supplement such as fetal bovine serum (FBS).

[0033] The cell fusion is carried out by thoroughly mixing prescribed amounts of the immunocytes and myeloma
cells in the medium, adding a solution of PEG preheated to about 37°C, the PEG having an average molecular weight
of approximately 1,000-6,000, for example, to the medium usually at a concentration of about 30-60% (W/V), and mix-
35 ing. A suitable medium is then successively added, and the supernatant obtained by centrifugation is removed. This
procedure is repeated to produce the target hybridomas.

[0034] The hybridomas are selected by culturing in a common selection medium, such as HAT medium (a medium
containing hypoxanthine, aminopterin and thymidine). Culturing in the HAT medium is continued for a sufficient time to
allow death of all the cells other than the target hybridomas (all the non-fused cells), which is usually from a few days
40 to a few weeks. The usual limiting dilution method is then employed for screening and monocloning of hybridomas pro-
ducing the target antibodies.

[0035] The hybridomas prepared in this manner that produce the monoclonal antibodies of the invention may be
subcultured in common medium, and may be placed in long-term storage in liquid nitrogen.

[0036] In order to obtain the monoclonal antibodies of the invention from the hybridomas, any suitable methods may
45 be employed, such as a method wherein the hybridomas may be cultured according to standard methods and the anti-
bodies may be obtained from the culture supernatants; or alternatively, a method wherein the hybridomas may be
administered to a compatible mammal for proliferation and then the antibodies may be obtained from the ascites fluid
thereof. The former method is suitable for obtaining highly pure antibodies, while the latter method is more suited for
mass production of antibodies.

50 [0037] The antibodies obtained by the aforementioned methods can be highly purified by utilizing standard purifi-
cation methods such as salting-out, gel filtration, affinity chromatography, or the like.

Monoclonal Antibody Fragments

55 [0038] The monoclonal antibodies of this invention may be the complete antibodies described above, or fragments
thereof. That is, they may be any fragments of a monoclonal antibody of the invention that specifically recognize human
Integrin Associated Protein and induce apoptosis of nucleated blood cells (myeloid cells and lymphocytes) having
human Integrin Associated Protein. Such fragments include Fab, F(ab') 2 , Fab', etc. These fragments can be prepared

5

EP 1 035 132 A1

by digestion with an enzyme such as papain, pepsin, ficin or the like. The properties of the obtained fragments can be
confirmed in the same manner as described above.

Peptides and Low Molecular Compounds Having the Same Function as the Monoclonal Antibodies

5

[0039] The monoclonal antibodies described above, which recognize human Integrin Associated Protein and
induce apoptosis of nucleated blood cells, also encompass peptides and low molecular compounds that likewise rec-
ognize IAP and induce apoptosis of nucleated blood cells.

10 Properties of Monoclonal Antibodies of the Invention

[0040] As specifically described in the following Examples, the monoclonal antibodies of the invention specifically
recognize human Integrin Associated Protein.

[0041 ] The monoclonal antibodies of the invention also induce apoptosis of nucleated blood cells (myeloid cells and
is lymphocytes) with human Integrin Associated Protein.

[0042] These properties can be utilized to obtain useful therapeutic agents in the field of treatment for myeloid
leukemia and lymphoid leukemia.

[0043] Thus, it will be readily appreciated that the construction of specific systems involving the use of the mono-
clonal antibodies of the invention, as antibodies to specifically recognize an antigen that causes apoptosis of nucleated
20 blood cells, for distinction and identification of the antigens, or the use of the unique properties of the monoclonal anti-
bodies as therapeutic agents for myeloid leukemia and lymphoid leukemia, as well as any modifications and applica-
tions of the system, are also within the scope of this invention insofar as they can be carried out by applying standard
methods that are obvious to those skilled in the art.

25 Antileukemic Agents

[0044] An antileukemic agent according to this invention is based on the fact that the action of IAP is promoted by
binding of an antibody or the like of the invention. While there are no particular limitations on the dose of the antibody
of the invention, it is preferably in the range of 5 jug to 500 mg/kg.

30

EXAMPLES

[0045] This invention will now be explained in greater detail by way of the following examples; however, the inven-
tion is not to be limited to these examples.

35

Example 1 (Monoclonal Antibody Preparation)

(1) Sensitizing antigen and immunization method

40 [0046] Antigen sensitization was accomplished using a recombinant cell line as the sensitizing antigen, which was
the L1210 cells transfected with human IAP gene and highly expressed the product. L1210 is obtained from the DBA
mouse-derived leukemia cell line (ATCC No. CCL-219, J. Natl. Cancer Inst. 10:179-192, 1949).

[0047] The human IAP gene was amplified by PCR using a primer with a human lAP-specific sequence (sense
primer: GCAAGCTTATGTGGCCCCTGGTAGCG, antisense primer: GCGGCCGCTCAGTTATTCCTAGGAGG) and

45 cDNA prepared from mRNA of HL-60 cell line (Clontech laboratories, Inc.) as the template (Fig. 1 ).

[0048] The PCR product was subcloned into a cloning vector pGEM-T (Promega Corporation) and used to trans-
form E. coli JM109 (Takara Shuzo Co., Ltd.), and after confirming the nucleotide sequence of the insert DNA with a
DNA sequencer (373A DNA Sequencer, available from ABI), it was subcloned with an expression vector pCOS1 .
[0049] Expression vector pCOS1 is a derivative of pEF-BOS (Nucleic Acids Research, 18, 5322, 1990), and it is a

so vector obtained by subcloning the neomycin resistant gene using human elongation factor-1 a as a promoter/enhancer.
This human lAP-subcloned expression vector was used for gene introduction into L1210 cell line with DMRIE-C
(GIBCO/BRL), selection was performed with Geneticin (final concentration: 1 mg/ml, available from GIBCO/BRL), and
the gene-introduced L1210 cells were cloned by the limiting dilution method.

[0050] The antigen expression of the obtained clones was examined using human lAP-recognizing anti-CD47 anti-
55 body (PharMingen), and the clones with high levels of expression were selected as antigen-sensitized cells (Figs. 2, 3).
Forculturing of the recombinant L1 210 cells, 10% fetal bovine serum (FBS, available from Moregate Inc.) and Iscove's-
Modified Dulbecco's Medium (IMDM) (GIBCO/BRL) were used as the medium, and the cells were subcultured in a 5%
CQ 2 incubator at a temperature of 37°C.

6

EP 1 035 132 A1

[0051] The immunized animals used were DBA/2 mice (bred by Charles River, Japan), which were of the same
strain as the L1210 cells. The human Integrin Associated Protein (IAP) gene-transfected L1210 cells, used for antigen
sensitization, were incubated for about 30 min with mitomycin C (Kyowa Hakko Kogyo Co., Ltd.) at a concentration of
200 |ug/ml, and after suspending growth of the cells, mitomycin C was thoroughly washed off prior to suspension in

5 PBS.

[0052] The cells were intraperitoneal^ injected into the mice three times at intervals of about 10 days, at approxi-
mately 5 x 1 0 6 cells each time. After the third immunization, blood was taken from the eye socket, the serum was diluted
50-fold with PBS containing 1 % BSA, and binding between the diluted serum and the recombinant L1 21 0 cells used for
antigen sensitization was confirmed with a FACScan (Becton Dickinson and Company) (Fig. 4); the mouse having the
10 best antiserum activity was subjected to a booster immunization with intraperitoneal injection of 1 x 10 7 cells 5 days
after the fourth immunization. Four days after the final immunization, the mouse was sacrificed and the spleen
extracted.

(2) Cell fusion

15

[0053] After thinly slicing the spleen extracted from the mouse, the dissociated spleen cells were centrifuged and
then suspended in IMDM medium, allowed to float, and thoroughly rinsed. Separately, the mouse myeloma cell line P3-
U1 [Current Topics in Microbiology and Immunology, 81 , 1 -7 (1 978)] was cultured in IMDM medium containing 1 0% fetal
bovine serum (FBS, available from Moregate Inc.), and after rinsing similarly with the IMDM medium, the 1 x 10 7 cells
20 were placed in a centrifuge tube in admixture with 5 x 1 0 7 cells of the spleen cells and subjected to cell fusion according
to a standard method [Clin. Exp. Immunol., 42, 458-462 (1 980)], using polyethylene glycol 4000 (Nakarai Chemical Co.,
Ltd.).

[0054] The resulting fused cells were then suspended in IMDM medium containing 10% FBS and a fused cell
growth stimulating agent (BM-Condimed H1, available from Boehringer Mannheim Biochemicals) and dispensed into a
25 96-well plate for culturing at 37°C in a 5% C0 2 incubator. On the following day, the cells were placed in the HAT selec-
tion medium and then the 10% FBS/IMDM medium containing the growth-stimulating agent, and culturing was contin-
ued to sustain growth.

[0055] In order to examine the effect of the culture supernatant of these fused cells on leukemia cell lines, the
medium for fused cells was replaced with IMDM medium containing 10% FBS, and culturing was continued to sustain
30 growth.

(3) Screening

[0056] The following screening was performed using the culture supernatant of the aforementioned fused cells.

35

[1] Primary screening

[0057] Cells of a mouse spleen stromal cell line (CF-1 cells) transfected with the human Integrin Associated Protein
(IAP) gene (recombinant cells into which the same plasmid was subcloned as the plasmid used to prepare the human

40 lAP-expressing L1 21 0 cells used for antigen sensitization) were seeded in a 96-well plate at 1 x 1 0 4 cells per well and
cultured overnight, and then fixed with 2% PLP (periodate-lysine-paraformaldehyde) to prepare an ELISA plate. After
rinsing, the plate was subjected to blocking for 1 h at room temperature using a 1% BSA solution, and after further rins-
ing, 50 jiil of the culture supernatant of each hybridoma was added for incubation at room temperature for one hour.
[0058] After rinsing, anti-mouse IgG+A+M (H+L) (Zymed Laboratories Inc.) labeled with alkaline phosphatase was

45 added prior to incubation at room temperature for 1 h. After rinsing, SIGMA 104 substrate (Sigma-Aldrich Corporation)
was added to provide a final concentration of 1 mg/ml, incubation was continued at room temperature, and the specific
activity was measured with a microplate reader (Model 3550, available from BioRad Laboratories Inc.).
[0059] As a result, appearance of hybridomas was confirmed in 2089 wells among the hybridomas seeded in 2880
wells, with 187 wells being positive in the primary screening. 50 \\\ each of Mouse lgG1 as a negative control and anti-

50 human CD47 antibody (BD PharMingen) as a positive control were added at a concentration of 3 |ng/ml, respectively,
prior to incubation at room temperature for 1 h.

[2] secondary screening

55 [0060] The clones judged as positive in the primary screening were subjected to an ELISA system using human
Integrin Associated Protein (lAP)-expressing CF-1 cells, where the negative control was CF-1 cells transfected with
only the expression vector pCOS1 , in order to screen whether the antibodies produced by the hybridomas would spe-
cifically recognize human IAP.

7

EP 1 035 132 A1

[0061 ] As a result, the positive was confirmed for 21 of the 1 87 wells found to be positive in the primary screening.
Table 1 shows the specific binding of human IAP with 7D2 and 11 C8 as representative examples among these, in terms
of the absorbance in ELISA. (Table 1 ) ELISA analysis of specific binding of hybridoma culture supernatants with human
IAP

5

Table 1

< Raw data )

PBS

ochCD47 3 jug/ml

7D2

11C8

CF1-pCOS1

0.185

0.160

0.189

0.149

CF1-MAP-55-8

0.192

0.456

0.568

0.812

(Subtracted)

PBS

ochCD47 3 jug/ml

7D2

11C8

Specific binding

0.007

0.296

0.379

0.663

15

[3] Tertiary screening

[0062] The clones judged to be positive in the secondary screening were subjected to a growth inhibition test using
20 Jurkat cells (human T cell lymphoma line) and ARH77 cells (human myeloma cell line). 1 00 julI of the Jurkat cells at 5 x
1 0 3 cells per well and the ARH77 cells at 1 x 1 0 4 cells per well were seeded in each well of a 96-well plate, and 5 or 1 0
(ill of culture supernatant of the hybridoma clones were added to the cell suspensions. After culturing for about 2 days,
the cell numbers were measured by MTS assay. As a control, 5 or 10 juJ each of IMDM medium containing 10% FBS
and culture supernatants of clones that were negative in the primary screening (8G2 and 9C5) were added.
25 [0063] Figs. 5 and 6 show the results of the growth inhibition effect of four representative clones, 11C8, 7D2-E3
(subclone of 7D2), 13F1 and2F12.

(4) Antibody properties

30 [0064]

[1] The immunoglobulin types of the culture supernatants of 1 1C8, 7D2-E3, 13F1 and 2F12 were examined using
an ELISA system.

Specifically, human Integrin Associated Protein (lAP)-expressing CF-1 cells were seeded into a 96-well plate
35 to prepare an ELISA plate, and then 50 |ulI of each culture supernatant was added, alkaline phosphatase-labeled

anti-mouse IgG antibody (Zymed Laboratories Inc.) or anti-mouse IgM antibody (Biosource Intl., Inc.) were reacted
therewith as secondary antibodies, and the activity was measured with a microplate reader. As a result, 1 1 C8 and
7D2-E3 were confirmed to be IgG, while 13F1 and 2F12 were confirmed to be IgM.

[2] The DNA fragmentation of the two clones 1 1 C8 and 7D2-E3 among the four clones described above was ana-
40 lyzed by flow cytometry (FACScan, available from Becton, Dickinson and Company) using Jurkat cells and HL-60

cells. The Jurkat cells were used for 1 1C8 and 7D2-E3, and the HL-60 cells were used for 1 1C8.

The Jurkat cells and HL-60 cells were seeded in a 1 2-well plate at 4 x 1 0 4 cells per well/2 ml, respectively, and
200 jliI of the culture supernatants of 7D2-E3 and 1 1 C8 were added. The cells were cultured for 2 days, and meas-
ured. As a control, 8G2 culture supernatant was added in an equal volume. The cells were recovered from the cul-
45 turing plate and a cell pellet was fixed under 200 x g for 60 minutes at 4°C in 2 ml of chilled 70% ethanol. The cells

were then centrifuged, rinsed in 1 ml of PBS and resuspended in 0.5 ml of PBS. To a 0.5 ml sample of the cells, 0.5
ml of RNAse (Type l-A, Sigma-Aldrich Corporation, St. Louis, MO, USA; 1 mg/ml in PBS) was added, and these
were mixed with a 1 ml propidium iodide solution (PI, Sigma, 100 jag/ml in PBS). The mixed cells were incubated
for 60 min in a darkroom at 37°C, and then kept in the darkroom at 4°C and measured by flow cytometry.
50 As shown in Figs. 7-9 and 10-11, the culture supernatants of 7D2-E3 and 1 1 C8 increase a proportion of apop-

tosis cells of Jurkat cells and the culture supernatant of 1 1C8 increases a proportion of apoptosis cells of HL-60
cells, respectively.

[3] The culture supernatants of 11C8 were used in a coculturing system with HL-60 cells using a feeder layer of
cells of the human myeloid stromal cell line KM1 02, to determine whether these culture supernatants induce apop-
55 tosis of HL-60 cells.

Specifically, KM 102 cells were seeded in a 2-well Lab-Tek Chamber Slide (Nalge Nunc Intl. Corporation) and
brought to a sub-confluent state, 1 x 10 5 cells of HL-60 cells were seeded thereon and cultured for about one day,
and then the non-attached HL-60 cells were removed. The aforementioned culture supernatants were simultane-

8

EP 1 035 132 A1

ously added to provide a final concentration of 1 0% and the cells were cultured for 2 days. After culturing, the cells
were fixed with 10% formalin and the apoptosis-induced HL-60 cells were detected by the TUNEL method
(ApopTag Plus available from Oncor Inc.). As shown in Figs. 12 and 13, the culture supernatant of 11C8 more
increases apoptosis cells of HL-60 cells than the culture supernatant of 9C5 does, which is the culture supernatant
5 of the human IAP non-reacting hybridoma clone used as the control.

(5) Antibody purification

[0065] For purification of the antibodies produced by hybridomas, the cell lines of the IgG-producing clones 7D2-E3
10 and 1 1C8 among the above hybridoma lines were intraperitoneal^ injected into pristane-administered BALB/c/AnNCrj
mice (male, available from Charles River, Japan) according to a standard method. After several weeks, the ascites fluid
produced was taken and the antibodies were separated and purified by standard methods. Specifically, the antibodies
were purified from the obtained ascites fluid by a Polos Protein A plastic column (Perceptive Biosystems Inc.) and dia-
lyzed with PBS (Dulbecco Inc.), and bands were confirmed with SDS-PAGE analysis. As shown in Fig. 14, electro-
ns phoresis using an authentic sample of mouse IgG (Cappel Inc.) as a control confirmed bands for the IgG of clones 7D2-
E3 and 1 1 C8 at the same positions as the authentic sample mouse IgG, under both non-reducing conditions and reduc-
ing conditions.

[0066] In this example, the human Integrin Associated Protein (lAP)-expressing L1210 cells were used as the sen-
sitizing antigen for illustrative purposes, but it is also possible to prepare monoclonal antibodies in the same manner
20 using other human lAP-expressing cells or human IAP itself, and to prepare monoclonal antibodies from an antibody
library using the phage display method; this invention is not limited to the aforementioned monoclonal antibodies but
encompasses all monoclonal antibodies with properties similar thereto and all hybridomas that produce those mono-
clonal antibodies.

[0067] Furthermore, the invention of these monoclonal antibodies also includes humanized antibodies, human anti-
25 bodies, chimeric antibodies, single-chain antibodies, primatized antibodies and antibody fragments obtained by digest-
ing the antibodies with various enzymes (papain, pepsin, ficin, etc.).

[0068] The hybridomas producing the monoclonal anti-human Integrin Associated Protein (IAP) antibodies of the
invention are novel fused cells created from DBA mice spleen cells and the mouse myeloma cell line P3-U1 as the par-
ent cells; anti-lAP antibody (mouse hybridoma 11C8-F8 (subclone of 11C8), designated as "MABL-1") was deposited
30 as FERM BP-6100 and anti-lAP antibody (mouse hybridoma 7D2-E3 (subclone of 7D2), designated as "MABL-2") as
FERM BP-6101 on September 1, 1997 with the National Institute of Bioscience and Human Technology, Agency of
Industrial Science and Technology, Ministry of International Trade and Industry, located at 1-3 Higashi 1-chome, Tsu-
kuba-shi, Ibaraki-ken, Japan, as an authorized depository for public microorganisms.

35 Example 2 (Subclass identification of MABL-1 and MABL-2 antibodies)

[0069] In order to identify the subclasses of MABL-1 and MABL-2 antibodies obtained above, 500 \x\ each of MABL-
1 and MABL-2 adjusted to 100 ng/ml was spotted on an Isotyping Kit (Stratagene), by which MABL-1 was shown to be
lgG1 , k and MABL-2 was shown to be lgG2a, k.

40

Example 3 (Human lAP-expressing human leukemia cells)

[0070] IAP expression in different human leukemia cell lines was detected by flow cytometry with human lAP-rec-
ognizing anti-CD47 antibody (a commercially available product). This antibody was used for the detection because

45 human IAP is believed to be identical to CD47 (Biochem. J., 304, 525-530, 1994). The cell lines used were Jurkat and
HL-60 cells (K562 cells, ARH77 cells, Raji cells and CMK cells). The cells were used at 2 x 10 5 cells per sample, the
anti-CD47 antibody was incubated with the cells at a final concentration of 5 jug/ml, and the secondary antibody used
was FITC-labeled anti-mouse IgG antibody (Becton Dickinson and Company). Mouse lgG1 antibody (Zymed Labora-
tories Inc.) was used as a control. The results of the flow cytometry as shown in Fig. 15 (HL-60) and Fig. 16 (Jurkat)

50 confirmed that both cell lines expressed IAP.

Example 4 (Apoptotic effect In vitro)
[0071]

55

(1) The apoptosis-inducing activity of the MABL-1 and MABL-2 antibodies on L1210 cells transfected with human
IAP gene, Jurkat cells and HL-60 cells were examined using Annexin-V (Boehringer Mannheim). The results of
analysis with Annexin-V are shown in Figs. 17-22, wherein the dots in the lower left region indicate the live cells,

9

EP 1 035 132 A1

those in the lower right region indicate apoptotic cells, and those in the upper right region indicate necrotic cells.
The antibodies used were mouse IgG (Zymed Laboratories Inc.) as a control and MABL-1 and MABL-2 at 1 0 jug/ml,
and after 4 x 1 0 3 cells of L1 21 0 cells transfected with the human IAP gene were incubated for 72 h and 6 x 1 0 4 cells
of the Jurkat cells were incubated for 48 h, they were analyzed with Annexin-V. Cell death was observed, as shown
5 in Figs. 1 7-22. For the HL-60 cells, 1 0 |ug/ml of MABL-1 was used, and analysis with Annexin-V at 1 x 1 0 5 cells like-

wise revealed cell death.

(2) The apoptosis-inducing activity of MABL-2 antibody Fab fragments on L1210 cells transfected with human IAP
gene was examined. Specifically, L1210 cells transfected with human IAP gene were cultured at 4 x 10 3 cells, and
MABL-2 antibody Fab fragments and mouse IgG as a control were used at a concentration of 10 jag/ml. The cells
10 were incubated for 72 h and measured with Annexin-V. As a result, considerable cell death was observed (Figs. 23,

24). The MABL-2 antibody Fab fragments used for the experiment were obtained by digesting the antibody with
papain (Pierce Laboratories, Inc.) and purifying it. The MABL-2 antibody Fab fragments were analyzed by SDS
electrophoresis (Fig. 25).

15 Example 5 (Investigation of apo ptosis in vivo)

(1) Drug efficacy of MABL-1 and MABL-2 (whole IgG)

[0072] Human lAP-expressing KPMM2 cells (human myeloma cell line) were transplanted into SCID mice, and on
20 the 10th day after transplantation, MABL-1 and MABL-2 (whole IgG) were administered by single intravenous injection
in a dose each of 5 jug/head and 50 jug/head, respectively (n=5); on the 28th day after KPMM2 transplantation, the
human IgG levels derived from KPMM2 were measured by ELISA, and the disappearance was confirmed. The survival
period was also examined. The results showed marked suppression of blood levels of human IgG in the groups treated
with MABL-1 and MABL-2, which represented the anti-tumor effect (Fig. 30). The survival period was also shown to be
25 notably lengthened (Fig. 26).

(2) Drug efficacy of MABL-1 and MABL-2 (F(ab') 2 )

[0073] F(ab') 2 fragments prepared by digestion of the MABL-1 and MABL-2 antibodies with pepsin and purification
30 with Protein A (Pierce laboratories, Inc.) were used to examine the anti-tumor effect except the cytotoxic effect via the
Fc regions. Specifically, human lAP-expressing KPMM2 cells (human myeloma cell line) were transplanted into SCID
mice, and MABL-1 and MABL-2 F(ab') 2 fragments were intravenously administered to the groups in a dose of 100
jug/head on the 6th and 10th days after transplanting, and to the groups in a dose each of 10 and 30 jug/head on the
6th, 8th and 10th days after transplantation, respectively; the human IgG levels derived from KPMM2 were measured
35 by ELISA on the 30th day after transplantation (Fig. 27). The survival period was also examined up to 90 days after
transplanting. As a result, a notable suppressing effect on human IgG levels in the blood was found in the groups treated
with MABL-1 and MABL-2, which represented the anti-tumor effect. The survival period was also considerably length-
ened (Fig. 28). Fig. 29 shows the SDS electrophoresis pattern for the F(ab') 2 fragments of MABL-1 antibody and MABL-
2 antibody.

40

INDUSTRIAL APPLICABILITY

[0074] The monoclonal antibodies of this invention are antibodies that specifically recognize human Integrin Asso-
ciated Protein, and the antigens that induce apoptosis of nucleated blood cells having human Integrin Associated Pro-
45 tein. Accordingly, they are useful as antibodies that recognize human Integrin Associated Protein for its distinction and
identification, while also having an action of inducing apoptosis of nucleated blood cells; these properties can be utilized
to prepare useful therapeutic agents in the field of treatment for myeloid leukemia and lymphoid leukemia.

50

55

10

EP 1 035 132 A1

SEQUENCE LISTING

<110> CHUGAI SEIYAKU KABUSHIKI KAISHA

<120> Monoclonal antibody inducing apoptos

<130> CGS98-03PCT

<160> 2

<210> 1
<211> 26
<212> DNA

<213> Artificial Sequence
<220>

<223> pcr primer

<400> 1

GCAAGCTTAT GTGGCCCCTG GTAGCG 26

<210> 2
<211> 26
<212> DNA

<213> Artificial Sequence

<220>

EP 1 035 132 A1

<230> PCR primer
<400> 2

GCGGCCGCTC AGTTATTCCT AGGAGG 26

Claims

15

1. A monoclonal antibody that induces apoptosis of nucleated blood cells having Integrin Associated Protein (IAP).

2. A fragment, a peptide or a low molecular compound of a monoclonal antibody that induces apoptosis of nucleated
blood cells having Integrin Associated Protein (IAP).

20

3. A hybridoma that produces a monoclonal antibody according to claim 1 .

4. An antileukemic agent comprising a substance that binds to IAP and stimulates the action of IAP to induce apop-
tosis of nucleated blood cells.

25

5. The antileukemic agent according to claim 4, wherein the substance is a monoclonal antibody.

6. The antileukemic agent according to claim 4, wherein the substance is a fragment, a peptide or a low molecular
compound of a monoclonal antibody.

30

35

40

45

50

55

12

EP 1 035 132 A1

Fig. 1

13

EP 1 035 132 A1

Fig. 2

CO

o

O

in

CM

05

to -

CO

~1 1 I I I I I II I I t t II HI I I I I 1 1 1 II | I I I II III |

10° 10 1 10 2 1 0 3 10 4

FL1-H

Fig. 3

in

04 -

in

O
O

<n -

CO

FL1 FITC

14

EP 1 035 132 A1

15

EP 1 035 132 A1

Fig . 5

Growth Inhibition of Jurkat

0 5A£l

NT 8G2 11C8 2F12 13F1 7D2-E3

HYBRIDOMA

16

EP 1 035 132 A1

Fig. 6

Growth Inhibition of ARH77

0 5,ul

Cont 8G2 11C8 2F12 13F1 7D2-E3

HYBRIDOMA

17

EP 1 035 132 A1

Fig. 7

O

O

• I

" I

" !

• l

• I
■

»

«

«

i ff'if'l 'TTr

200 400 600 800 1000

FL3-H

o

O

400 600 800 1000

FL3 PI

CO

o
O

FL3-H

18

EP 1 035 132 A1

19

EP 1 035 132 A1

Fig.12A

0 m

*

F/g. 12B

T — .

20

EP 1 035 132 A1

Fig. 13A

Fig. 13B

21

EP 1 035 132 A1

Fig. 14

22

EP 1 035 132 A1

23

EP 1 035 132 A1

17

O f

9807 1 3 .002

1 .06V*

I M i ll! I I I T I I M [ 1 t I I It \ \

10 1 10 2 10 3
Annexin V-FITC

10

18

o

o

CCN

^ o -

a: 21

930713.004

38.81%

44.04%

J I I T 1 II HI I I | I II If I 1 I 1 I III J — I — J I mi n f

"*10° 10 1 10 2 10° io 4

Annexin V-FITC

24

EP 1 035 132 A1

980713.006

*

1 •

*

•

•

*

*

*

« «

*

• *

4.17%.

• *

*

•

•

m

19.63*/.

nrm

10*" 10
Annexin V-FITC

10

980522.001

1.0S%

2-9SV.

T 2
10^

1 ¥ T

nm(^ » f i i h i f

10^ 1 0^

Annexin V-FITC

25

EP 1 035 132 A1

.22

930522.003

1- I I I IHII| 1 I

10 u 10 ]

10" 10
Annexin V-FITC

26

EP 1 035 132 A1

.23

O 1

O -

980713.002

o ,

*

■ V .

•

•

I"

♦

• •

• •

1.06%

•

m

•

m

•

% ' • • 3.85%

• a • 4

1

» 1 • 1 1

10" 1 0 2 10
Annexin V-FITC

10

24

1

980713.012

0 • •

m / •

23.79%

39.66%

1 O ^ 4

10 l 10~ 10^ 10*
Annexin V-FITC

27

EP 1 035 132 A1

28

EP 1 035 132 A1

Fig. 26

t

CO

<

Q

O
CO

CM

>

CO

CO T3

"O O CO

CO -C CD

i: ^ o)

^ to in

8 3 2

O CD CQ

E

to

c/>
CO

Q

10

to

Survival Ratio (%)

29

EP 1 035 132 A1

Fig.27

hlgG Level in KPMM2 SCID (day30)

12 r

CD

E

o

o

a)

1 0

8

I

mlgG

X

10 30 100
MABL-1

p<0.0S
•* : P<0.001

# * *

10 30 100
MABL-2

MoAb F(ab')2 (pg/head)

30

EP 1 035 132 A1

3f. 28

CM

CO

CM
i

QQ
<

Q

O
CO

CM

CL
O

I

CO

"O CO CO <D
CO <1> 0) -C

CD ^ 7r

i: D) o) ^
^. o o o

O ^ CO r-
° CM CM CM

T— | | t

CD m m co
o)< < <

CO

... T

9

»

CD

CM

CM

co co cm

Survival Ratio (%)

31

EP 1 035 132 A1

Fig. 29

Intact (whole) MABL-1
MABL- 1 F(ab') 2
Intact (whole) MABL-2
MABL- 2 F(ab%

32

EP 1 035 132 A1

Fig. 30

hlgG Level in KPMM2 SCJD (day 28)

1 o

CI

E

8

u

u
a

at

4*

: p < 0. o l

SO 5
MABL-1

SO s
MABL-2

Mo Ab Whole IgG (pg/head)

33

EP 1 035 132 A1

INTERNATIONAL SEARCH REPORT

International application No.

PCT/JP98/04118

A CLASSIFICATION OF SUBJECT MATTER

Int. CI 6 C07K16/18, C07K16/28, C12N5/20, A61K39/395 // C12P21/08,
C12N15/06

According to International Patent Classification (IPC) or to both national classification and IPC

B FIELDS SEARCHED

Minimum documentation searched (classification system followed by classification symbols)

Int. CI 6 C07X16/18, C07K16/28, C12N5/20, A61K39/395, C12P21/08,
C12N15/06

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched

Electronic data base consulted during the international search (name of data base and, where practicable, search terras used)
WPI (DIALOG) , BIOSIS (DIALOG)

C DOCUMENTS CONSIDERED TO BE RELEVANT

Citation of document, with indication, where appropriate, of the relevant passages

Relevant to claim No.

P, X

WO, 97/32601, Al (CHUGAI SEIYAKU KK) ,

12 September, 1997 (12. 09, 97)

& JP, 9-295999, A fc AU, 9722325, A

Journal of Cell Science vol. 108, No. 11 (1995)
Martina I. Reinhold et al., "in vivo expression of
alternatively spliced forms of integrin-associated
protein (CD47)* p3419-3425

1-6

1-6

I | Further documents are listed in the continuation of Box C. See patent family annex.

"A"
"E"

"O"

Special categories of cited documents:

documeat defining the general ataie of the art which is not

considered to be of particular relevance

earlier document but pubUabed oa or after the international filing date
document which may throw doubts on priority daisy*) or which is
cited to establish the publication dale of another distort or other
special reason (as specified)

referring to an oral disclosure, use. exhibition or other

documeat published prior to the ioteraadooal filing dale but
the priority date

-X"
"8l

later document published after the iatemational filing dsic or priority
date and not ia conflict with uie uppticenou but cited to underataad
the principle or theory underlying the uveanou

cicvanoe; the claimed invention c ann ot be
or cannot be oosslncied to iavotve aa Inventive step
when the document is taken alone

doc um ent of particular relevance; the claimed invention caanot be
considered to involve an inventive step when the doenment is
oouanned with one or more other such documenh
being obviotts to a pcraon dulled in the art
of the same patent family

Date of the actual completion of the international search
11 December, 1998 (11. 12. 98)

Date of mailing of the international search report

22 December, 1998 (22. 12. 98)

Name and mailing address of the ISA/

Japanese Patent Office

Facsimile No.

Authorized officer

Telephone No,

Form PCT/ISA/210 (second sheet) (July 1992)

34